An Analysis Of Louise Erdrich s The Red Convertible

Mailk Sims Often times, an inanimate object can be as important and sometimes more important than the characters of the story. In Louise Erdrich s The Red Convertible, the car played the same important role as the characters did, but for different reasons. Two brothers, Lyman and Henry, had very little in common other than their blood. One day they decided to catch a ride to Winnipeg. The car was introduced while these two were doing some sightseeing in the city. They spotted the red Oldsmobile convertible. Lyman, the storyteller, almost made the car a living thing when he said, There it was, parked, large as life. Really as if it were alive. (461) The brothers used all of the money they had, less some change for gas to get home, to buy the car. The car s significance was the bond that it created between the brothers. The purchase of the vehicle brought these two together with a common interest: the car. Once the bond was formed, the brothers became inseparable, at least for a while . The boys spent the whole summer in the car. They explored new places; met new people and furthered the bond that the car had created. When they returned from their trip, Henry was sent to war. He left the car with Lyman. While Henry was gone, Lyman spent his time pampering and fixing the car. Lyman saw the car as an extension of Henry. Lyman used the car to maintain an emotional bond with his brother who was thousands of miles away. During the war, Henry was taken P.O.W. and spent timeShow MoreRelatedThe Red Convertible By Louise Erdrich931 Words   |  4 Pages In the short story â€Å"The Red Convertible,† by Louise Erdrich, there are multiple literary devices used throughout. However, Erdrich most commonly utilizes theme and symbolism. She uses certain themes throughout most of her work, as noted by Keri L. Overall in a literary analysis. â€Å"Indeed, the themes of Erdrich’s stories range from the effects of war on families and personal identity to loss of heritage and family and personal relationships.† Erdrich also employs the use of symbolism in this story

Persuasive Technology Using Computers to Change What We Think and Do Free Essays

REFERENCE AND CITATION FORMAT FOR THE COMMUNICATIONS OF THE ACM DR ANDY DONG The Association for Computing Machinery is the pre-eminent professional body dealing in all aspects of information technology. This is a style guide for their reference and citation format. Note that there are some slight stylistic differences between the format for the magazine Communications of the ACM (per the style in EndNote) and the ACM conference proceedings reference format (per the style in the ACM conference proceedings template). We will write a custom essay sample on Persuasive Technology: Using Computers to Change What We Think and Do or any similar topic only for you Order Now This document will describe the Communications of the ACM style. Windows 7 Check Your Understanding iframe class="wp-embedded-content" sandbox="allow-scripts" security="restricted" style="position: absolute; clip: rect(1px, 1px, 1px, 1px);" src="https://phdessay.com/windows-7-check-your-understanding/embed/#?secret=eR3dNfel6t" data-secret="eR3dNfel6t" width="500" height="282" title="#8220;Windows 7 Check Your Understanding#8221; #8212; Free Essays - PhDessay.com" frameborder="0" marginwidth="0" marginheight="0" scrolling="no"/iframe In practice, adherence to a single, consistent style is satisfactory. References Section The References section appears at the end of the paper. All references appear alphabetically by the lead author’s last name and are numbered consecutively. A clear header should be used to indicate the start of the References. Example: References 1. Bless, H. The Interplay of Affect and Cognition. in Forgas, J. P. ed. Feeling and Thinking: The Role of Affect in Social Cognition, Maison des Sciences de l’Homme and Cambridge University Press, Cambridge, 2000, 201-222. . Garcia, A. C. B. and Howard, H. C. Acquiring design knowledge through design decision justification. Artificial Intelligence for Engineering Design, Analysis and Manufacturing, 6 (1). 59-71. Citation As you write your report, you will cite your references. A citation to a reference in the body of the text is indicated by a bracketed number corresponding to the reference number in the References section. Example: During high stress periods, individuals should focus on the situation-specific tasks rather than rely on general knowledge structures. 1] Reference Formats GENERAL INSTRUCTIONS A complete reference should contain the name(s) of the author(s) and/or editor(s), the title of the article, the name of the book or conference proceedings where appropriate, and bibliographic information about the article such as the name of the publisher, the city of publication, and the page numbers. The basic concept is that the reference should be sufficiently complete so that the reader could readily find the reference and can judge the authority and objectivity of the reference. All author names appear as Lastname, Initials. For example, if Andy Dong is the primary author and Alice M. Agogino is the second author, the correct appearance of the author names would be: Dong, A. , and Agogino, A. M. THIS IS THE REFERENCE FORMAT FOR A BOOK. Authors. Title. Publisher, City of Publication, Year of Publication. Example: 1. Fogg, B. J. Persuasive technology: using computers to change what we think and do. Morgan Kaufmann Publishers, Boston, 2003. THIS IS THE REFERENCE STYLE FOR AN ARTICLE WHICH APPEARS IN AN EDITED BOOK. Authors. Title. n Editors Title of edited book, Publisher, City of Publication, Year of Publication, Pages. Example: 1. Fischer, G. and Nakakoji, K. Amplifying designers’ creativity with domain-oriented design environments. in Dartnall, T. ed. Artificial Intelligence and Creativity: An Interdisciplinary Approach, Kluwer Academic Publishers, Dordrecht, 1994, 343-364. THIS IS THE REFERENCE STYLE FOR A JOURNAL OR MAGAZINE ARTICLE. Authors. Title. Journal or magazine name, Volume (Issue), Pages. Example: 1. Hirsh, H. , Coen, M. H. , Mozer, M. C. , Hasha, R. and Flanagan, J. L. Room service, AI-style. IEEE intelligent systems, 14 (2). 8-19. THIS IS THE REFERENCE STYLE FOR A CONFERENCE PROCEEDINGS. Authors, Title. in Title of conference, (Location of Conference, Year), Publisher, Pages. Example: 1. Leclercq, P. and Heylighen, A. 5,8 Analogies per hour: A designer’s view on analogical reasoning. in 7th International Conference on Artificial Intelligence in Design, (Cambridge, UK, 2002), Kluwer Academic Publishers, 285-303. THIS IS THE REFERENCE STYLE FOR ELECTRONIC MEDIA (ARTICLES, IMAGES, ETC. ) RETRIEVED FROM THE WEB. FOLLOW THE REFERENCE FORMAT FOR A JOURNAL ARTICLE AND THEN INCLUDE INFORMATION ABOUT THE WEB SITE AND THE DATE WHEN YOU RETRIEVED THE RESOURCE. NOTE THAT THE DATE OF PUBLICATION AND THE DATE OF RETRIEVAL OF THE ARTICLE MAY NOT BE THE SAME. WHEN THERE IS NO DETERMINATE DATE OF PUBLICATION, USE (N. D. ) IN THE DATE FIELD. WHERE POSSIBLE, INCLUDE THE NAME OF THE ORGANIZATION HOSTING THE WEB SITE. Examples: In the following example, the Cornell Chronicle is a regular newsletter which is published online. Thus, we follow the journal/magazine format and include the volume and issue. Steele, B. Look, Ma, no wires! Cornell class project tests wireless networking, Cornell Chronicle, 31 (35). Retrieved February 15, 2004, from Columbia University: http://www. news. cornell. edu/Chronicle/00/5. 18. 00/wireless_class. html. The following Web page has no evident author, but the â€Å"Revised date† in the footer gives us the date of publication. MIT Project Oxygen: Overview, 2004. Retrieved March 15, 2005, from Computer Science and Artificial Intelligence Laboratory, Massachusetts Institute of Technology: http://oxygen. lcs. mit. edu/Overview. html. How to cite Persuasive Technology: Using Computers to Change What We Think and Do, Essays

Trend Analysis for Public - Positively or Negatively- myassignmenthelp

Question: Discuss about theTrend Analysis for Public, Positively or Negatively. Answer: This paper focuses on the emerging trends in the health sector and the method used to identify these changes. These alterations could either impact the involved parties that are, the patients, doctors and the general public, positively or negatively. Following the advancements in technology patients can get a diagnosis as well as a prescription from the comfort of their homes, offices and even cars (Lautier, 2014). Technology has helped ease the long queues at the hospitals, but in case of a misdiagnosis, the patient suffers as they get the wrong medication. Also included in the paper is a recommendation to the editor on an article about the two trends that should be published to enlighten the public. Criteria Used to Identify the Trends The method I used to identify the trends in the health sector was comparing and contrasting the type of services offered by various hospitals and picked the ones using the most recent technology. Most hospitals in this digital error are using software applications to register, monitor their patients health and also in receiving payments (Lautier, 2014). The first trend I identified is the use of tracking gadgets that are worn and help supervise and notify the wearer of things such as the level of calories he or she has consumed that day and also monitoring physical activity (Case, Burwick, Volpp, Patel, 2015). Some come in the form of a wristband. A survey recently carried out in Singapore showed that 60% of the population is open to this type of technology (Case, Burwick, Volpp, Patel, 2015). The second trend is the patient-focused care meaning that the ailing will be the center of all the services provided in a hospital to ensure that he or she is fully engaged and satisfied with his or her treatment. These two trends will impact health both positively and negatively. The wearable device will assist the owner in knowing about his or her health status and the dos and donts of healthy living (Crawford, Lingel,Karppi, 2015). It also provides a chance for a person to be in charge of his or her health at the same time monitoring the rate at which the heart is beating. Also, it provides a ground for the people to compete online(Crawford, Lingel,Karppi, 2015). On the downside, however, this service is only limited to a particular percentage of the population, those that are not apt technologically get left out. The patient-focused care will enable patients to get connected to their physicians from any location and discuss matters of their health without having to frequent the hospital or clinic each time a problem arises (Kitson, Marshall, Bassett, Zeitz, 2013). The patients will also have a variety of doctors at their disposal at pocket-friendly costs. Recommendation Following thorough research, it has come to my understanding that most people in Singapore are not informed about the developments taking place in the health sector. Writing an article about the medical tracking devices in the form of wristbands will go a long way in educating the people on their benefits. This is a critical issue that needs to be addressed especially among the young adults who are coming up with innovations to support their generation. Setting the pace for them today means they will bring exceptional changes tomorrow because the bar is already set high enough. I cannot think of any better feeling than being able to monitor your health, exercises, and nutrition from any location (Case, Burwick, Volpp, Patel, 2015). The article will also help in answering the question of privacy raised by the people when they heard about this technology since 40% of them were against their medical records going public. References Case, M. A., Burwick, H. A., Volpp, K. G., Patel, M. S. (2015). Accuracy of smartphone applications and wearable devices for tracking physical activity data. Jama, 313(6), 625-626. Crawford, K., Lingel, J., Karppi, T. (2015). Our metrics, ourselves: A hundred years of self-tracking from the weight scale to the wrist wearable device. European Journal of Cultural Studies, 18(4-5), 479-496. Kitson, A., Marshall, A., Bassett, K., Zeitz, K. (2013). What are the core elements of patient?centred care? A narrative review and synthesis of the literature from health policy, medicine and nursing. Journal of advanced nursing, 69(1), 4-15. Lautier, M. (2014). International trade of health services: Global trends and local impact. Health policy, 118(1), 105-113.

Notre Essays - Notre Dame Fighting Irish Football, Films, Rudy

Notre Dame Football The Notre Dame Legend In this epic tale of courage, bravery and persistence is made of exciting magnitude and loyalty of one man, named Rudy, to fulfill his life-long dream to play for Notre Dame University on the football team. His pride to become part of the Nation's best football team was his dream, to become an All-American hero. His struggles in life were of tremendous value to him. All around him, all his life, family and "friends" had put him down and told him that he will never become a Notre Dame team member. His realization for life began as his dear friend died. As to then, Rudy has dedicated himself into becoming a part of the Notre Dame Varsity football team. His first engagement with the priest led him to begin school at the Holy Cross Community College. The priest had promised him that if he had studied hard enough and had received good grades, then he would then be granted another free semester and so on. Until then, Rudy had visited the field on where the desired football team played, being escorted shortly off by the keepers of the field. He then rushed to the Head Coach to enlist onto the team but could not because he was not a full-time student at their College. If he had done well enough, then the Father again promised him entry into the Notre Dame Campus. Rudy's persistence to become part of the team had taken sympathy from the father of the church. He soon began attending college at this University. He had later encountered a companion to aid Rudy so that he may pass his classes with above-average grades. Of course, in return, his newly greeted friend, Peabody, was of a shy sort and had wanted his help into being introduced to some women of his class. Peabody had also wanted to leave for the University of Miami to study the profession of Law. Peabody was one of the very few friends, which Rudy adored. He had promised to help Rudy study and pass his courses as long as he had helped him with the "Female Department". Peabody had also promised Rudy that he would be at the first starting game that he was in. Peabody was also very fond of Rudy, because they watched each other's backs. As fate had it, as Rudy advanced in his classes, he had kept enrolling into Notre Dame University only to be turned down, time after time after time. Rudy then applied for attendance upon the Booster Club for the team after deliberately lying that he was enrolled in the school. He was caught doing so after Peabody had asked him to find out if a girl had a boyfriend or not for him, since that was the deal they had made; studies for girls. As to then, Rudy had attended all of the team's Pep Rallies and the such but was later discovered to have not been in the school's list of alumni due to failure to show a valid School Identification. Rudy was too dedicated to let his dreams off too easily as this. He applied for recruitment of the Field Maintenance crew, which worked on the field of the legendary Notre Dame team. His employer stated to him that to never give up his dreams to do whatever he wanted to do in life. This had a bit influential part upon Rudy himself though he had his goal set to make the team, no matter what. His employer had also"pretended" to not know of the key which was found in the office, which Rudy stated was big enough for a person to live in. As well that his other new friend, his boss, knew he did not have a place of his own, until then. Since Rudy was a Freshman at Holy Cross College, he had spent all of his precious time studying and practicing vigorously to make his name appear on that list and to make the dress cut. As so, for the following, hard, two years, he was never accepted to his school of choice. When the Christmas Holidays had arrived, Rudy returned home to visit his parents and the rest of his family. His mother greeted him with joy as to see her son once again but his father was in a very ill mannered mood. At the fact that his son had received stupendous grades at the Holy Cross Community College, he did not accept

4 Rules For Creating Awesome Content Your Audience Loves

4 Rules For Creating Awesome Content Your Audience Loves I know you’re not just another aimless blogger (or podcaster, video maker, [insert  what you do  here]) looking to clutter up the Internet. You have a specific purpose behind your content. You want to create content  that is valuable for your audience and grows your business. That’s the good news. The bad news is that, even with a noble purpose like that one, it’s really hard to get your content noticed. 4 Rules For Creating Awesome #ContentMarketing Your Audience Will Love via @sonjajobsonNo one is looking for plain old â€Å"accurate† or â€Å"relevant† content anymore. They don’t have to look for it because it’s flooding their inbox and social streams constantly, like an all-you-can-eat buffet. Your audience wants something more. They want content that not only provides accurate and relevant information, but something that applies to their specific situation, something they can relate with, and something that helps them make real, significant improvement in their life. Whether you’re aiming to teach, inspire, or entertain with your content, use the following 4 rules to create content  that your audience will love, share, and come back for. No one looks for accurate or relevant #content. Thats everywhere. Yours has to be better.Rule #1 – Not All Topics Are Created Equal Your readers are very picky. And why shouldn’t they be? Somewhere around 2 million blog posts are written every day. That’s a heckuva lot of content to choose from. So when it comes to picking a topic for your next blog post or video, it’s worth putting in a little extra time- and research- to get it right. And there’s one more thing to consider: A content topic that sounds great to you might not sound great to your audience. In order to stand out from the sea of content we’re all swimming in, you need to get inside your readers head. And here’s how to do it. Step 1: Stop confusing â€Å"audience† with â€Å"peers†. Sometimes when we sit down to create content, we accidentally slip into peer-mode. This is when we  create content that we  think will be impressive in our  industry. The problem is this: Content that impresses others inside  our industry isnt necessarily what will impress our  audience. Make sure you’re addressing topics that will help your viewers, not your peers. A topic that sounds great to you might not sound great to your audience. #blogging #contentmarketingStep 2: Do some Internet stalking. The very best way to find out what your audience really wants to know about is to go straight to the source. Look at questions your readers are asking, the problems they are struggling with, and the solutions they are searching for. Scour the comments sections on other related blogs to see what people are asking about. Check out QA websites like Qu0ra and Yahoo! Answers. Scan  profiles on social media for complaints, questions, or rants. This is all fodder for your next irresistible piece of content. Research  questions, problems, struggles, and solutions. #contentmarketing #bloggingStep 3: Look before you write (or record). Most topics have already been written about. It’s really hard to come up with a 100% original idea to create content on, so I’m not going to suggest you try and do that. But you should avoid creating content that is nearly interchangeable with what’s already out there. So after youve decided on a topic, do a quick Google search to turn up other content written on the subject. Ask yourself, â€Å"how can I improve on what’s already being said?† and â€Å"were there any questions left unanswered in that post/video/etc.?† and â€Å"how can I put my own spin on this subject?† Connect with your audience by improving on the #content that already exists. #contentmarketingRule #2 – Relate With Your Audience Earlier, we talked about how there is an abundance of blog  posts written every day, and how almost every topic has already been written about. This has led to a very important shift in what people are looking for online. Instead of searching only for accurate information and helpful tips, they are looking for those things piled on top of a style, personality, or a view point they can relate to. Your audience might have read a dozen blog posts on how to choose the right color paint for their kitchen remodel, but they might not really get it until they hear it from you. Your unique perspective, background, opinions, and personality will make your content unique. It won’t appeal to everyone, but it will appeal very strongly to those that relate with you (aka your dream customers or readers). So how, exactly, do you tap into what makes you you in order to create content that your readers can relate with? Start by getting comfortable showing some vulnerability. Get vulnerable with your audience. Share  opinions, values, and failures. #bloggingWhen we put our opinions, values, past failures (and even successes) out there, we open ourselves up to some degree of push back. But we also open ourselves up to a whole new level of connection with our audience. People can find facts anywhere- what they really want is the story. Your story. Rule #3 – Stay Focused Youve probably heard the expression that people have the attention span of a goldfish online. It’s true that almost all of your visitors have their cursor hovering over the back button, so it’s vital that you find a way to capture and keep their attention. One of the best ways to accomplish this is to stay focused. Bunny trails, long-winded introductions, and off-topic side notes are great ways to lose your visitor’s attention. Choose one very specific  topic for each piece of content, and then stick to it. If you try to tackle a topic that’s too large, you’ll feel yourself drifting from point to point. Bunny trails, long-winded introductions, and off-topic side notes lose attention. #bloggingHere’s a trick for making sure your content is focused: Identify the outcome you want for your audience after they view  your content. What one thing do you want them to learn, understand, or get inspired about? At every paragraph, bullet point, and sub-header, ask yourself â€Å"does this help my visitor accomplish that one specific goal?† Does every paragraph, bullet point, and sub-header help your audience accomplish a specific goal? #4 – Give Them An Easy Win Remember the outcome you identified a minute ago for your audience to achieve after viewing your content? This is the step where you drive that home and create  content so valuable that your audience will love it, share it, and come back for more. We know that valuable content should help our audience achieve something (whether it’s a specific goal, a lifestyle change, or even a mindset shift), but achieving it is often a process. We all tend to resist starting a new process- whether it’s for a lack of time, motivation, or courage- so how can you help people act on your content? The simple answer: Make it ridiculously simple to do so. The actual process of achieving the outcome your content was created to produce might take a while (say, losing weight), so break the process down and identify one, tiny step your audience can take in that direction. For our â€Å"losing weight† example, maybe this small step is identifying one thing they could do today to eat just a little bit healthier or get in an extra 10 minutes of exercise. Choose something very small that your audience can do for an easy win. It will build momentum toward that goal. This transforms your content from something abstract into something actionable.

Book Summary Essay Example for Free

Book Summary Essay The book I chose to read was â€Å"When I Say No, I Feel Guilty† by Manuel J. Smith. The first thing to stand out to me in this book was it seemed a little outdated. Even though the writing style and the examples appeared to be from a different era, I was still able to see how different points were relevant today and to me personally. This title screamed my name when I was browsing the list of choices because no matter what I am saying no to, I always feel guilty. From the first moment that we can feel and translate emotions, we have been manipulated by others. We have grown up under the sense that we should feel certain ways about particular actions. We forget to a chore when we are young, we should feel guilty. We bring a bad grade home on out report card, we should be scared of getting in trouble. Many activities are labeled either good or bad and we should portray emotions to match. As a manager, you should try to keep commands or statements neutral. A neutral statement is one that doesn’t assign the label of good or bad to a behavior so the recipient will not feel manipulated. Everyday, people try to manipulate you into doing what they want by making you feel nervous, uninformed, or blameworthy. If you let them push you around you will feel frustrated, angry or depressed. When you permit others to control your actions, you renounce your sense of personal responsibility. Smith states that the first step in fixing the situation is to know that â€Å"no one can manipulate your emotions or behavior if you don’t allow it to happen. † Also, following the Bill of Assertive Rights will help lead to non-manipulative relationships in all situations. The rights are the basis for all healthy relationships and are listed as: You have the right to judge your own behavior, thoughts and emotions, and to take the responsibility for their initiation and consequences upon yourself. You have the right to offer no reasons or excuses for justifying your behavior. You have the right to judge if you are responsible for finding solutions to other people’s problems. You have the right to change your mind. You have the right to make mistakes – and be responsible for them. You have the right to say, â€Å"I don’t know†. You have the right to be independent of the goodwill of others before coping with them. You have the right to be illogical in making decisions. You have the right to say, â€Å"I don’t understand†. You have the right to say, â€Å"I don’t care†. The first right is the foundation of all of the remaining rights. When you become your own judge, you help to build a barrier against manipulation. Judgements should be based on your values and not external systems of what is right or wrong. People base their manipulative actions on the belief that you should live up to their rules. If you are accepting of this situation, you open yourself up to a limitless variety of manipulation. Criticism is a common tool people use to get someone to behave according to their standards. Reactions to criticism can be negative with anxiety, denial, and defensiveness. Learning to take criticism in a constructive manner helps to avoid manipulation. Verbal coping methods to help accept criticism effectively are fogging, negative assertion, and negative inquiry. Fogging is when you only agree to the truths in a statement and respond to what someone has specifically stated rather than what is implied. A negative assertion is statement that takes responsibility for something you have done wrong. It takes courage to make a negative assertion and say, I’m sorry. Last, using negative inquiry encourages the critic to reply assertively instead of manipulatively. This tactic is typically used to ask for additional information about a critique. There are also different types of relationships that fall into three categories, commercial, authority, and equality. Basic verbal skills used to minimize manipulation do not change as problems are handled throughout these different relationships. Commercial relationships are clearly defined with a contract. Since this type of relationship follows a defined structure an assertive verbal skill works most effectively. In an authority relationship there is one person in charge while the other is not. Authority based relationships emphasize finding compromises that grow on existing interpersonal dynamic. Both parties are equal in an equality relationship. This relationship is the most informal and tends to have everything open for discussion. Thoughtful open communication reassures people that you will not hinder their decision making, even if you may disagree. The main concept I took away from this book is, it’s my life and what happens in it is completely up to me! I will not cower when I face manipulation. My reactions to particular situations can pave the way for a disaster or a triumph. We must always be in touch with reality to promote our own well-being and happiness. We also have to accept the possibility that changing our mind is completely normal and healthy. Keeping the Assertive Bill of Rights in mind will help to stand up against manipulation and keep our dignity, self-respect, and control over our own behavior. Book Summary. (2018, Oct 21).

Marketing and advertisement Essay Example | Topics and Well Written Essays - 3000 words

Marketing and advertisement - Essay Example Advertisement is a detailed process and hence quite a bit of thought and planning goes into advertising campaigns, as a complete campaign comprise of print ads, radio ads and television ads, all meant to maximize results for the client or business being advertisement. This paper tries to understand the various ways through which the UK CAP Codes (CAP/BCAP Codes) can be reformed. Advertisement can be seen in different perspectives. As defined above, the purpose of advertisement increase the number of articles or products sold. As if this is not enough, advertisement is also a very important aspect in the political scene as politicians use ads to sell their manifestos (DYER 1988, pg67). Advertisement developed into a big business in the 20th century, creating numerous jobs in advertisement agencies and the marketing industry. The growth in advertisement has been made possible through advance use of the media like newspapers, television, radio, magazines, direct mails and the internet. Advertising has developed to an international business strategy, since producers and companies try to sell their products on a globalized market in almost every corner of the world (DYER 1988, pg112). Business is all about who knows you rather than who you know. Advertising generates sales and opportunities through building awareness of products and services. Identifying of the ideal customer and understanding their motivation behind buying the products is core to the advertising production process.... in advertisement has been made possible through advance use of the media like newspapers, television, radio, magazines, direct mails and the internet. Advertising has developed to an international business strategy, since producers and companies try to sell their products on a globalized market in almost every corner of the world (DYER 1988, pg112). Business is all about who knows you rather than who you know. Advertising generates sales and opportunities through building awareness of products and services. Identifying of the ideal customer and understanding their motivation behind buying the products is core to the advertising production process. It is a fact that the process of advertising is a complex one and is therefore characterized by some costs (PAGELL & HALPERIN 1997, pg45). Therefore advertising agencies should avoid cost overrun by reviewing their adverts before incurring additional charges. Good advertising process should also ensure that the final product includes the ne cessary contact information, together with any needed mention of pricing or a special offer. In this regard, the entire advertising process requires a lot of responsibility. Knowledge of the laws is important to advertisement planning because of complexity of communication and the diverse perceptions of customers in response to promotional communications (DYER 1988, pg63). Media ethics is an elusive topic that will change from medium to medium from audience to audience and from person to person. Thus, I cannot write this paper from the perspective of right and wrong (MARLIN 2002, pg34) .Whenever a group of individuals are poses some power to influence the lives of others, ethical obligations becomes domineering. Ethical issues are imperative in considering different courses of action, and

Federal Acts Affecting MIS Research Paper Example | Topics and Well Written Essays - 250 words

Federal Acts Affecting MIS - Research Paper Example For instance, this act forces the cable operators and service providers to provide a printed guideline containing information on public privacy whenever a connection is issued to a person. This act increased the customers’ confidence by ensuring a great deal of privacy and security of their information. On the other hand, this act forced the cable operators not to disclose their customers’ information as well as get approval of the customer prior to making use of their information. In this scenario, this act has offered an excellent support for ensuring the security of customer data (PUBLIC ACCESS AWARENESS ASSOCIATION, n.d; University of Miami School of Medicine, 2005). The telephone consumer protection act (TCPA) was introduced in 1991 and it was aimed at making sure that people are not pressurized by telemarketers as well as have the facility to avoid. Additionally, it also allows people to restrict autodialed calls that have the capability to connect two or more lines of a traditional communication structure of multi-line business. In addition, this act also ensures that the customers do not get unwanted publicity material via faxes connected to the personal telephone. Moreover, this act is an excellent solution for dealing with telephone technology abuse. Furthermore, this act also allows customers to ensure the safety of their personal information and data (Aydenemma, 2012; FCC, 2012; American Teleservices Association, 2012; Direct Marketing Association,

Message vs. Style in Things Fall Apart, by Chinua Achebe Essay Example for Free

Message vs. Style in Things Fall Apart, by Chinua Achebe Essay The message is more important than the style. I totally disagree with this statement in the context of Things Fall Apart as I believe that in this particular work, the message is of equivalent importance to the style; to have a particular writing style whose sole purpose is found in informing readers as to the purpose to the message, and then to NOT have a message, would be useless, whereas having a message to tell readers, WITHOUT such a writing style as is necessary to allow them to absorb the purpose, would again be useless- therefore the message and writing styles are equally important in this story, as one cannot do without the other. In this case, the central message of Things Fall Apart, that African culture is complex, can only be absorbed by readers if Achebes writing style, which incorporates the use of dialogue, conflict, proverbs, diction and setting, allows them to develop such recognition of cultural complexity- the author cannot merely instruct the reader to believe that the culture is indeed complex, and still expect the reader to believe as such without question. Firstly, Achebe makes ample use of dialogue as a component of his writing style to carry forth the message of a culturally complex society. For example, Okonkwos conversation with Obierika as to the Oracles desires in Chapter Eight introduces significant cultural elements to the readers. Okonkwo argues that his participation in the murder of Ikemefuna was justified, but Obierika contends otherwise, declaring that Okonkwos actions are of the kind for which the earth goddess, Ani, wipes out whole families. In the conflict between their different views we see the strong influence exerted by their religion on each person, and also acquire recognition of significant religious elements, namely the Oracle and the earth goddess. That Okonkwo and Obierika should have differing opinions about the Oracles religious intentions indicates the presence of complex perceptions of the same religion. This complexity in religious perceptions then implicitly suggests to readers an inherent complexity in the religion itself, for without such complexity differing religious perceptions would not occur. Religion is a core component of culture, as clearly the culture of a society must not contradict the religious views held by that same society, and having a complex religion as a component of culture in turn suggests that the culture of the society must be complex as well. Dialogue thus serves to carry forth Achebes message that African culture is complex. At the same time, in the suggestions of complex culture found in dialogue, we see how Achebes style of writing encourages readers to gradually reach a perception of his central message on their own, which is important in that the readers must themselves perceive such cultural complexity through development of their own thoughts on the issue- exactly as Achebe intended. To have a dialogue without any inherent message would also make such dialogue purposeless, as Achebe could not possibly describe an overarching purpose to that conversation. This shows how dialogue as a component of the writing style gives such a writing style an importance equal to that of the message; without dialogue being employed as such, readers cannot acquire knowledge of the message, whereas if there was no message, then dialogue would have no purpose. Dialogue as a component of the writing style thus creates a situation where the style is of equal importance to the message. Secondly, traditional African proverbs, a significant element of Achebes writing style, are used to highlight cultural complexity. An example would be Okonkwos declaring that a childs fingers are not scalded by a piece of hot yam which its mother puts into its palm in defence of his participating in the murder of Ikemefuna. He argues that he did as such due to the Oracle declaring that Ikemefuna would have to be killed. That proverbs can be casually used in dialogue to illustrate various points, such as the above proverb serving as a defence for ones actions, is an indication of a highly-developed language. A societys culture is based upon its language, for language serves as the primary medium of communication between humans in a society, and as such readers recognize that language is an important component of culture, therefore having a highly-developed language would thus suggest that society is culturally complex. Proverbs being thus used in Achebes writing style have therefore led to the subtle formation of such a suggestion to readers, which in turn allows readers to follow through on that suggestion, and thereby reach the conclusion that African culture is complex is nature- this being the exact message which Achebe is trying to bring across to readers. Proverbs being a component of Achebes writing style, we can see how they contribute to the carrying the message of cultural complexity across. However, such a writing style also finds its primary purpose in carrying a message; therefore without such a message of cultural complexity, the proverbs would lose their meaning. In this sense, we can safely state that the writing style, through its encompassing the use of proverbs, is of equal importance to the message. Thirdly, Achebes choice of diction also plays a very large role in his writing style. Throughout the story, the narrator refers to the housing for Okonkwos wives as Obi, court messengers as Kotma, and characters use traditional welcomes such as Nno. That such traditional African words should appear throughout the story, interspersed with all the English words, gives readers the impression that such words cannot be simply translated into English. This then suggests to us that language in the society must be very highly developed, for such words do not have a counterpart in the English language, despite the vast vocabulary of the latter. Indeed, I had to refer to the glossary in the book for the English translations of such words. When readers make such inferences, they cannot help but come to the conclusion that the Africans cannot be culturally primitive- to have such a highly-developed language must in turn suggest a highly developed culture, which is exactly the message Achebe is trying to bring across. Thus Achebes choice of diction greatly aids his writing style in carrying the message across to readers, who realize from such implicit suggestions the central message of this work. Indeed, if Achebe did not wish to have a message of cultural complexity, it is plausible that such traditional African words would not appear. Thus we can see how the success in carrying the message across is highly dependent on the writing style, and the shaping of the writing style itself is highly dependent on the type of message being carried across; the message and the style are equally important. Lastly, Achebes description of the various settings in which events take place play a part in shaping his particular writing style. The setting of Ezeudus funeral in Chapter Thirteen is an example of how the setting as a component of Achebes writing style serves to carry forth the message of cultural complexity. Ezeudus funeral was a warriors funeral, and now and then an ancestral spirit, or egwugwu, would appear from the underworld. From the description of this setting, readers are able to more readily appreciate the complexities of traditional African culture; that their culture incorporates a strong, pagan belief in the existence of supernatural beings, the egwugwu, and a similar belief in the existence of an underworld. This places emphasis on a major religious component in their culture. Ezeudus funeral being considered as a warriors funeral also allows us to acquire insights into the importance of a particular social class, the warrior class, in their society. The setting has thus contributed to readers being able to recognize two major components in African culture, the former being religion, the latter being a social component. That these two different components should become so elaborately intertwined in this one ceremony is evidence of a complex culture. The reader, in reviewing the description of the setting, thereby acquires knowledge of the central message of cultural complexity which Achebe is trying to bring across, without Achebe having to explicitly declare as such; this clearly shows how Achebes writing style of placing information from which readers have to make their own inferences has led to our understanding the message of the novel. Without such a description of the setting, readers might not have been able to absorb this message. On the other hand, without a message, the description of the setting would be useless, as the purpose of such a writing style would be to enlighten readers as to a particular message the author wishes to convey. Therefore I believe that writing style and the message are of equal importance. In conclusion, I believe that the writing style and the message are of equal importance, as the former serves as the vehicle for the latter, whereas the latter exists to give the former purpose. Neither can do without the other, and therefore their interdependence lends them equal importance.

Rochester Business Plan Essay -- essays research papers fc

A Marketing Plan to Retain Rochester’s Youth   Ã‚  Ã‚  Ã‚  Ã‚  Rochester’s 18-28 year old population has been leaving this city in mass amounts. This is common knowledge, and our plan is targeted towards the target audience in efforts to keep them here for a longer duration of time.   Ã‚  Ã‚  Ã‚  Ã‚  We feel that there are several beautiful attractions that make up the Greater Rochester Area of which this target audience is unaware. This marketing plan aims to get this market out into the suburbs and city of Rochester to see the diversity and unique options that our area provides. This will alleviate the negative stigma held by the 18-28 demographic by bringing to their attention the ample business and recreational opportunities available. We seek to build a stronger sense of community through interactions with businesses, local marketing campaigns, and more effective communication with this demographic.   Ã‚  Ã‚  Ã‚  Ã‚  With our creative and influential ideas we intend to retain Rochester’s young adults so that the city will flourish with a new generation of hope. 1. Current Situation  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  page 2 2. Target Audience  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   3 3. SWOT 5 4. Trends  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   6 5. Benchmark Cities  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   7 6. Evidence   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   9  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   7. Marketing Objectives and Goals  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  &... ...nbsp;  $97,470  Ã‚  Ã‚  Ã‚  Ã‚  $126,080  Ã‚  Ã‚  Ã‚  Ã‚  $146,102 Mass Transit  Ã‚  Ã‚  Ã‚  Ã‚  10.50%  Ã‚  Ã‚  Ã‚  Ã‚  36.70%  Ã‚  Ã‚  Ã‚  Ã‚  3.30%  Ã‚  Ã‚  Ã‚  Ã‚  1.80%  Ã‚  Ã‚  Ã‚  Ã‚  2.80% Bike/Walk  Ã‚  Ã‚  Ã‚  Ã‚  9.00%  Ã‚  Ã‚  Ã‚  Ã‚  11.10%  Ã‚  Ã‚  Ã‚  Ã‚  4.10%  Ã‚  Ã‚  Ã‚  Ã‚  4.60%  Ã‚  Ã‚  Ã‚  Ã‚  5.70% Sunny Days  Ã‚  Ã‚  Ã‚  Ã‚  170  Ã‚  Ã‚  Ã‚  Ã‚  207  Ã‚  Ã‚  Ã‚  Ã‚  171  Ã‚  Ã‚  Ã‚  Ã‚  217  Ã‚  Ã‚  Ã‚  Ã‚  213 Source: www.bestplaces.net  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Works Cited www.bestplaces.net www.cincinnati.com www.ci.rochester.com www.detnews.com www.dol.gov www.Menshealth.com NYSDOL-http://64.106.160.140:8080/lmi/index.html www.pittsburghlive.com http://www.rbj.net/PDF_Files/AnnualEst.pdf www.retainthebrains.com Mills, James Edward. â€Å"Magnet Aims To Keep Young Professionals In Madison.† Wisconsin State Journal, July 2004. http://www.madison.com

Four Little Girls

Documentary Film Analysis Worksheet For History 221 and History 222 Professor Tondeur Instructions: †¢ You will find the list of films you can choose from in the Lesson section of the course. †¢ Go to the list and pick your film. You must view the entire film. If you can’t access films because of deployment, geographic location, or other reasons, please let your instructor know so they can give you an alternate assignment. †¢ You must answer in complete sentences, using a short answer/paragraph format. Cut and paste your answers into the Student Submission box for Assignment #2 and submit it as a Word document. 1. What is the title of the film you picked? 2. Why did you pick this film over the others offered? 3. What is/are the central message(s) of this documentary/fictional film? Be specific. Use examples from the film to support your choice. 4. Consider the effectiveness of the film for this history class. What are its strengths and weaknesses of this film in documenting history? . How do you think the filmmakers want the audience to respond? Is there a social justice message? If so, what is it? 6. Did the documentary leave you with any unanswered questions? If so, what were they? 7. How did this film change any misconceptions or stereotypes you had about the subject matter? If so, what were they? 8. What is the most important thing you learned from watching the film? 9. Why is this film important to understanding contemporary African American History?

Nutrition of Young Athletes

Nutrition for Young Athletes Heather Rushing Houston Community College November 11, 2011 Abstract Research surrounding the nutrition of young athletes suggests that they are at risk for becoming deficient in most of their vital nutrients. Most parents agree there is concern for this issue, but they fear they do not have enough information on how to fix the problem. This literature review includes several professionals and experienced groups’ opinions and highlights the ways to tackle the issue of nutritional deficiencies and the many pressures young athletes face. Nutrition for Young AthletesYoung athletes face a multitude of challenges especially those that surround their diet. The social, emotional, and physical aspects of their growing bodies can present unique dilemmas that parents of young athletes may not know how to approach. When training them on the proper techniques to be an all-star player it should always include a well-balanced diet along with positive affirmation s. For those who are looking for solutions to a proper diet for young athletes, busy lifestyles, pre and post activity meals and emotional pressures dietitians and doctors are finding the right information.It may be demanding for parents when one or more of their children are athletes. This can challenge their abilities to multi-task and unhealthy food choices may result from a hectic family sporting lifestyle. Carmen, a mom and article writer from gatorade. com, gives the busy parent helpful tips on how to choose better options from fast-food menus. Treating the family does not have to consist of greasy burgers and fries every time one visits McDonald’s, but choosing one of their snack wraps loaded with grilled chicken and the salad with no dressing will only amount to 300 calories (Carmen, 2011).Even Starbuck’s now offers on-the-go choices that include fresh fruit plates with cheese and protein packed plates that include hard boiled eggs and peanut butter. It is impo rtant to remember that proteins are just one of the many nutrients needed to complete a well-balanced diet for budding athletes. The University of Waikato in New Zealand offers plenty of information for a parent in search of what particular nutrients are needed and in what amounts. The nutrients that should compose young athlete’s diet are under two categories, Micro and Macro.Under the micronutrient category are calcium, iron, B-complex vitamins, and zinc. These vitamins and minerals are only needed in small amounts but are essential to the growth and development of children including their immune functions (The University of Waikato, 2011). Macronutrients, which are needed in large amounts, include the energy supplier’s carbohydrates, proteins, and fats (The University of Waikato, 2011). Current research suggests that more young athletes are showing deficiencies in all of these nutrients (Nisevich, 2008).To gain the proper amounts of vitamins and nutrients one should look first to food sources. Although there are vitamin supplements for young children, supplements are not the ideal source for these nutrients. Calcium rich foods such as milk, broccoli and other green vegetables support the growth of bones and increase their mass; they also help in the contraction of muscles and the impulses of nerves (Nisevich, 2008). Iron, which can be found in meat and beans, is â€Å"a major player in the role of energy metabolism of carbohydrates, protein, and fats† (Nisevich, 2008, para. ). Zinc and B-complex vitamins which include folic acid, niacin, riboflavin, B6, B12 and thiamin are used primarily to help the blood. Zinc supports tissue growth and wound healing while B-complex vitamins help to keep muscles from getting sore and maintain cognitive brain function (Nisevich, 2008). If a diet is well-balanced in meats, fish, beans, and diary those vitamins and minerals should be in adequate levels within the body. Consciously selecting what goes in t he bodies is the key to living and performing at one’s best.When young athletes are exposed to strenuous workouts pre and post activity meals as well as proper hydration are all crucial for their bodies. Activities lasting for at least one and half to two hours should be considered strenuous, especially sports such as rowing, cross-country running, and competitive swimming (Gavin, 2011). On a big day of activities meals should be given three hours prior to the event that deliver ample amounts of carbohydrates and low fats (Gavin, 2011).These types of food are converted into energy and the body will utilize them throughout the activity. Adding good carbohydrates such as whole grain cereals with low fat milk, peanut butter on whole wheat toast with half an apple, or lean meat on a pita with orange juice are ways to pack energy boosting foods into snacks (Baylor College of Medicine, 2004). Planning a healthy snack can benefit young athletes especially during performances. Before , during, and after an event are times when it is crucial to hydrate. It is needed on many levels for the body to function properly.Water supplies energy, strength as well as coordination and parents, coaches and young athletes should know that â€Å"even mild dehydration can affect performance† (Gavin, 2011, pg. 2). According to Collins (2007), a noted dietitian, drinking 5-9 ounces of water every 15-20 minutes depending on age and size is recommended. Collins (2007) also mentions that parents can weigh children before and after an event to determine how much fluid has been lost, drinking one cup per half pound they have lost will replenish their bodies.According to a known medical educator, Mary Gavin (2011), â€Å"after exercising for sixty to ninety minutes, the body has used up its readily available sources of energy; so sports drinks may be a good choice for kids who participate in strenuous activity for more than an hour† (p. 2). The nutrients in sports drinks s uch as sodium and potassium are exactly what athlete’s need when they are active for long periods to replace what was lost through sweat, but water should still be their main source of hydration (Gavin, 2011). Sports have long been associated with proving how tough you are through stamina and strength.In my opinion, these attributes can be helpful as well as harmful to an impressionable child athlete. Teammates that seem â€Å"stronger and better† can create a poor self-image within a young athlete who doesn’t feel he or she fits the physical criteria that coaches are looking for. Devastating effects can result from forcing the body to achieve optimal appearance. Athletes may increase weight and mass by overeating to try and reach desired outcomes while unknowingly putting their selves at risk. â€Å"When a person overeats, the food the body can’t immediately use gets stored as fat† (Gavin, 2011, p. ). Other types of athletes may try crash diets to lose weight for sports like wrestling, gymnastics, swimming and dance. This behavior leads to â€Å"less strength and endurance and poor mental concentration† (Gavin, 2011, p. 2). It is easy to buckle under the pressures of sports, but an emphasis on positive self talk and giving pats on the back for a job well done go a long way in a child. Reminding a child that it is just a game and everyone gets hurt and feels pain can bring feelings of lowered self-confidence into perspective.When the media splashes drug use and misconduct of famous athletes who children idolize in the news can create challenges for the child and the parent. It may help to explain the hard realities of the pressures to performance to a child by instilling simple values that shape their existence. In my opinion, simple values will give them a firm footing in life and a level head when they are faced with challenging life decisions. The list of questions concerning nutritious foods and sports pressures ar e endless.The known facts about micro- and macro-nutrients help tremendously when it comes to preparing snacks for young athletes and their sporting events. Fast-food choices can now be made without ruining the waistline from meals that contain excess calories and fat, therefore giving relief to busy parents of young athletes. Overeating and under eating are becoming a higher priority among doctors, dietitians and parents. As the pressure to perform is increasing, the need to educate young athletes and their parents on proper nutrition is paramount.The parent’s ability to obtain accurate information about nutrition from trusted bloggers, doctors, and dietitians can make the process of raising healthy young athletes much easier. References Baylor College of Medicine (2004, November 4). Proper nutrition should be part of training young athletes. Retrieved from Baylor College of Medicine, Houston, USDA/ARS Children’s Nutrition Research Center website: http://www. bcm. edu /cnrc/consumer/archives/athletes. htm Carmen 5, CafeMom user (2011, October 11). Articles & Advice [Supplemental material]. Healthier Fast Food Options.Retrieved from http://www. gatorade. com Collins, K. (2007, May 25). Nutrition Notes [Supplemental material]. Fuel your young athlete for peak performance. Timing, size and type of meals matter—so do fluids. Retrieved from http://www. msnbc. msn. com Gavin, M. L. (2011, November). Feeding Your Child Athlete. Retrieved from The Nemours Foundation, Kids Health website: http://www. kidshealth. org/parent/nutrition_center/dietary_needs/feed_child_athlete. html# Nisevich, P. M. (2008, March). Sports Nutrition for Young Athletes: Vital to Victory. Today’s Dietitian, 10, no. 3, 44. Retrieved from

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids The WritePass Journal

Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract Mitotic recombination in Schistosoma mansoni and Schistosoma rodhaini hybrids Abstract1. Introduction1.1 Schistosomiasis1.2 Genetic diversity; transmission and epidemiology of S.mansoni1.3 Drug resistance and vaccine development1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation1.5 Studying the genetic diversity of S.mansoni using molecular techniques2. Materials and Methods  2.1 Bioinformatics – RAPD primers2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers2.4 Analysis of RAPD PCR products 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products3. Results3.1 Bioinformatics – RAPD primers  3.2 PCR products from the amplification of DNA from cercariae using RAPD markers3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers4. Discussion4.1 DNA extraction4.2 Evidence of mitotic recombination in Schistosomes4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomesReferencesRelated Abstract Random amplified polymorphic DNA markers and second internal transcriber region primers   have been used to assess the genetic diversity of Schistosoma mansoni and Schistosoma rodhaini hybrids. 20 schistosome hybrids were used and within these parasites 6 different genotypes were present. However,1 genotype was   in females and in males and so was not sex specific. The genetic diversity within this parasite population is caused by mitotic recombination occurring in the asexual stage of the life style.   This is thought to occur due to its ability of evading the snail immune system, hybrid breakdown and increased movement and turn over of the snail host. The Red Queen Hypothesis is also suggested as a reason for genetic diversity in the schistosome population. Key words: Schistosoma mansoni, Schistosoma rodhaini, DNA extraction, polymerase chain reaction, hybrids, RAPD, mitotic recombination, genetic diversity, ITS-2. 1. Introduction 1.1 Schistosomiasis Schistosomiasis is endemic in counties where there is inadequate sanitation and no access to clean water resulting in 700 million people worldwide being at risk of infection and 207 million people already infected (World Health Organisation 2011). The leading cause is Schistosoma mansoni, a blood fluke that causes intestinal schistosomiasis. This parasite is found in Africa and South America where it is a serious health problem (Simoes et al. 2007). The disease can manifest with abdominal pain, diarrhoea, dysentry and in some severe cases cause hepatosplenomegaly which is enlargement of the liver and spleen (World Health Organisation 2011). The adult worms are found in the venules that surrond the intestine (Mann et al. 2009). It is the eggs in the tissues of the gut and deep body organs rather than the adult worms that cause of the pathology of the disease by releasing proteolytic enzymes which result in an inflammatory response (Clerinx and Gompel 2011). 1.2 Genetic diversity; transmission and epidemiology of S.mansoni The World Health Organisation (2011) have highlighted that schistosomiasis is now the second most important parasitic disease after malaria in terms of public health and economic impact, enhancing the severity of the problems that schistosomes can cause. Therefore, further research into methods which   will improve understanding of genetic variation of S. mansoni in the context of epidemiology and disease transmission in endemic areas (Durand et al. 2000). Considering the distribution of genetic diversity within the parasite population allows for a greater understand of the epidemiological factors which could influence the prevalence   of the disease (Thiele et al. 2008), especially with the concern of drug resistance and heterogeneity in virulence and pathology cause by different parasite population (Caillaud et al. 2006). 1.3 Drug resistance and vaccine development Praziquantel is commonly used to treat schistosomiasis and there is evidence to suggest resistance is becoming apparent (Ismail et al. 1999). The presence of non-synonymous mutations can affect the binding sites of drugs because these mutations are able to cause structural alterations in proteins causing drug resistance (Simoes et al. 2007). For this reason Berquist et al. (2002) suggest that a vaccine is needed against schistosomiasis as contemporary drugs such as praziquantel do not halt the transmission of the infection or stop re-infection from occurring. Due to the variability of antigens, studying the range of epitopes across the S. mansoni population is vital to vaccine development (Curtis and Minchella 2000). 1.4 Mitotic recombination in the S. mansoni life cycle causing genetic variation During the life cycle of S. mansoni (Figure 1) the miracidium infect Biomphalaria snails which act as the intermediate host which produce cercariae, humans are infected when cercariae penetrate the skin (Gryseels et al. 2006). Recombination occurs at a much lower frequency in mitosis than meiosis and is usually a rare occurrence (Archetti 2003). However, genetic diversity within the population of S. mansoni is caused by mitotic recombination during the asexual stage of the cycle (Bayne and Grevelding 2003). Grevelding (1999) also showed that the heterogeneity found among clonal cercariae all coming from a single miracidium infection, was a result of mitotic recombination events within the snail host during sporocystogenesis.   Mitosis should usually cause a single genotype, however, mitotic recombination is thought to be the cause of genetic diversity because of the presence of multiple genotypes. Figure 1 – The life cycle of Schistosoma mansoni In contrast, Sire et al. (1999) suggest that genetic diversity is greatly reduced when there is a single miracidium infection, this is justified in the study as they found that 88.4% of the snails produced single – parasite genotypes when infected with a single miracidium. However, they also found that a smaller amount of snails harboured multiple genotypes, evidential of mitotic recombination occurring. 1.5 Studying the genetic diversity of S.mansoni using molecular techniques Gower et al. (2007) suggested that a relevant problem in the in molecular studies of schistosomes is that adult worms are not easily available to study due to where they are found in the human body as they are in blood vessels that surround the intestine. Therefore, most studies involve infecting snails and using the cercariae to either infect laboratory mammals in order to extract the adult worms, or using the cercariae for their DNA and then conducting molecular studies (Gower et al. 2007). Molecular markers can be used to assess the genetic diversity by identifying parasite genotypes that have been collected from snail hosts (Dabo et al. 2007) Random amplified polymorphic DNA markers use oligonucleotides as primers to amplify DNA fragments (Lynch et al. 1994) . Sire et al. (1999) studied the genetic diversity and the distribution pattern of S.mansoni genotypes using RAPD markers and found that there were different genotypes of the parasite, 49 in total. RAPD markers are seen to be advantageous due to several factors such as quick analysis, but a major advantage is that they are able to detect numerous sequences in the DNA (Barral et al. 1996). RAPD markers are also reproducible as it is possible to the same genotype from the same individual numerous times (Figure 2 – Gel picture for reproducible RAPDs). However, an issue with using RAPD markers is that usually only highlight dominant genes (Barral et al. 1996). As they are also random a limitation is that it is not possible to know exactly where in the sequence that marker has attached itself to. Restriction fragment length polymorphisms can also be used to analyse DNA sequence differences in S.mansoni, highlighting the genetic diversity within the parasite population (Rodrigues 2002). By using other molecular markers that are highly polymorphic such as microsatellites, which are simple sequences of tandem repeated DNA (Chambers and MacAvoy 2000), the genetic diversity of S.mansoni between different hosts can be studied (Durand et al. 1995).   Gower et al. (2007) also suggest that the use of multi-locus microsatellites to highlight the genetic variation of schistosome larvae will enhance the knowledge about what is known of the epidemiology of the parasite. In this study RAPD markers were used to assess the genetic diversity of cercariae from a single miracidium infection, 10 female and 10 male S. mansoni and S. rodhaini hybrids. ITS – 2 primers were also used to discover if there was any genetic diversity amongst the second internal transcribed region of the ribosomal gene complex. The use of RAPD primers in this study should be able to show that mitotic recombination is happening within the asexual stage of the life cycle. The hypothesis of this study is to show that through the use of RAPD and ITS-2 primers mitotic recombination is occurring within the asexual stage of the schistosome life cycle. 2. Materials and Methods   2.1 Bioinformatics – RAPD primers Bioinformatic analysis was performed on 5 different RAPD primers (Table 1) to show that the primers attach themselves to random parts of the DNA sequence. The scaffold, the position in the scaffold and the features marking that part of the sequence were noted. This gave a complete genome perspective by ensuring that the primers were not binding to specific gene types or to a single region of the genome. Table   1. RAPD markers and the sequences they attach themselves to. RAPD primer Sequence OP- A9 GGGTAACGCC OP- A13 CAGCACCCAC OP G13 CTCTCCGCCA OP- A10 GTGATCGCAG OP B6 TGCTCTGCC 2.2 Comparison of DNA extraction methods: Beltran et al. (2008) and DNeasy protocol For the first DNA extractions a number of snails, Biomphalaria glabrata were infected with a single miracidium infection. In total 12 snails were infected for this experiment and 32 cercariae were collected from each snail. The DNA extraction method used on the cercariae was proposed by Beltran et al. (2008). For the DNA extraction 8 cercariae from a single snail which were each isolated   in 5 µl of purified water and then transferred to an eppendorf tube. 20 µl of NaOH (250mM) was then added to each tube and this was incubated for 15 minutes at 25 ºC. The samples were then heat shocked at 99 ºC for 2 minutes. The next step taken was to add 10 µl HCl (250mM), 5 µl   of Tris – HCl (500mM) and 5 µl   of Triton X – 100 ºC (2%) and this was again heat shocked at 99 ºC for 2 minutes. The samples were then stored at 20 ºC ready for PCR to be performed. The second method for the DNA extraction used a DNeasy protocol to extract the DNA from 20 schistosome hybrids. The hybrids used were produced from mono miracidial infections of Biomphalaria with female S.mansoni from Egypt and male S.rodhaini from Burundi from a previous experiment performed by Dr Scott Lawton. Firstly, 200 µl of AL was added to each of the schistosomehybrid DNA samples and was mixed by vortexing, following this 200 µl of ethanol was then added to each sample before vortexing again. This mixture was then placed into a DNeasy Mini spin column 2ml collection tube and centrifuged at 8000rpm for 1 minute. The DNeasy mini spin column was then placed into a new 2ml collection tube, 500 µl of buffer AW1 was added and it was again centrifuged for 1 minute at 8000rpm and again the DNeasy mini spin column was placed into a new 2ml collection tube. 500 µl of buffer AW2 was then added and was centrifuged for 3 minutes at 14 000rpm. The DNeasy column was then placed into a microcentrifuge tube and 200 µl of AE was added directly onto the DNeasy membrane, incubated at room temperature for 1 minutes and then then centrifuged at 8000rpm for 1 minute. 2.3 Amplification of cercariae and Schistosome hybrid DNA by Polymerase chain reaction (PCR) using RAPD primers PCR was performed using five primers described previously (Table 1); OP A9, OP A10, OP A13, OP G13 and OP B6. 2.5 µl of each DNA sample, 2 µl of each of the 5 different primers and 12.5 µl of PCR master mix containing Taq DNA Polymerase were added into separate PCR tubes. The DNA samples were firstly heated to 95 ºC for 15 minutes, then subjected to 40 cycles of 95 ºC for 1 minute followed by single cycles of 47 ºC for 1 minute and 72 ºC for 2 minutes. There was then a final elongation stage of 72 ºC for 10 minutes and then finally run to 4 ºC 2.4 Analysis of RAPD PCR products All PCR products were analysed using agarose gel electrophoresis was used to separate the DNA. 1% agarose gel was used in TAE and   8 µl of GelRed 10 000X in water (Biotium) was added to the gel. 5 µl   of each DNA sample was mixed with loading dye and placed into each separate well in the gel. A ladder was placed along side the DNA samples using a Bioline Hyperladder 1 ranging from 200bp to 10 000bp. The gel rack was then connected to the power supply and was allowed to run for 40 minutes. This gel was then visualised using a gel doc system. 2.5 Amplification of schistosome hybrid DNA by polymerase chain reaction (PCR) using ITS-2 primers and the analysis of the PCR products For the PCR using ITS-2 primers, 2 primers were added to each DNA sample from 5 female and 5 male schistosome hybrids, ITS-F (GGTACCGGTGGATCACGTGGTG) and ITS-R (CCTGGTTAGTTTCTTTTCCTCCGC). 2.5 µl of each DNA sample was added to a separate PCR tube, to this 12.5 µl of   PCR master mix (Thermo-Scientific) containing Taq DNA Polymerase, 5.0 µl of ITS-F and 5.0 µl of ITS-R was also added to each separate PCR tube. The PCR was then run at 95 ºC for 15 minutes, followed by 40 cycles at 95 ºC for 1 minute. The samples were then subjected to single cycles of 52 ºC for 1 minute and 72 ºC for 2 minutes and there was a final elongation stage at 72 ºC for 10 minutes before being run at 4 ºC. The PCR products were then run agarose gel electrophoresis using the same method used for the RAPD primers and the gel was visualised using a gel doc system. Sequencing of the ITS -2 regions was unsuccesful and therefore sequencing generated by Steinauer et al. (2008) were analysed to access if any mixing of the parental genotypes had occurred by identifying differences in single nucleotide polymorphisms within the F1 offspring. Sequences were downloaded from NCBI and aligned using clustalW2 (ebi.ac.uk/Tools/msa/clustalw2/). Alignments were then visualised using BioEdit to visualise nucleotide differences between the sequences. 3. Results 3.1 Bioinformatics – RAPD primers   BLAST searches on the RAPD primers showed that some of the sequences that the primers attached themselves to coded for proteins whilst others did not, highlighting that they are random (Lynch and Milligan 1994). Primers appear to bind to [rachel da1]  the different parts of the DNA sequence, for instance part of the sequence which codes for a specific protein and features marking that part of the sequence are shown. Where there is no feature it means that the sequence is a non-coding region (Table 2). Table 2. BLAST analysis on the RAPD primers 3.2 PCR products from the amplification of DNA from cercariae using RAPD markers Using the DNA extraction method suggested by Beltran et al. (2008) no PCR products were present on the gel when agarose gel electrophoresis was used (Figure 2). This method was therefore no longer used and the DNeasy kit was employed.    Figure 2. Gel picture showing that no DNA was present. 3.3 PCR products from the amplification of DNA from schistosome hybrids using RAPD markers RAPD PCR products from 10 female and 10 male schistosome hybrids were indicative that there were 4 genotypes found in the female DNA; A, B, C and D and 2 in the male DNA; E and F (Figure 3). However, genotypes D and F are the same, one being in the female population and one in the male showing that they are not sex specific. Figure 3. Showing 5 different genotypes in the schistosome hybrids. Genotype A: 1, 2, 4, 5, 6. Genotype B: 3. Genotype C: 10. Genotype D: 7, 8, 9. Genotype E: 11, 14, 17,18,20. Genotype F: 12, 13, 15, 16, 19. Table 3 shows the different sizes of each of the bands present for each genotype. Table 3. The size of bands present in each genotype 1000bp 800bp 600bp 200bp Genotype A * * * Genotype B * * * * Genotype C * * ** Genotype D * * * Genotype E * * Genotype F * * * *Band present **Double band present 3.4 PCR products from the amplification of DNA from schistosome hybrids using ITS -2 primers Double banding patterns were seen in the ITS – 2 PCR fragments, this is unexpected as the PCR should have produced a single discrete band (Figure 4). Figure 4.   Bands are present at 400bp and 200bp in both the male and female schistosome hybrids. It was not possible to sequence the ITS-2 region and so published data was used and analysed as described previously. Clear mixing of the parental genotypes can be seen (Table 4). For each SNP position mixing can be seen in the offspring with some nucleotides being from the S. mansoni parent and some from the S. rodhaini parent. [rachel da2] Table 4. Single nucleotide polymorphisms betweeen the parent species of Schistosoma mansoni (yellow) and Schistosoma rodhaini (red) and the resultant F1 offspring for published data on the ITS-1 marker. The SNPs appear not to exist as alleles and clear mixing of the parental genotypes can be seen in the offspring. SNP position 97 224 284 419 589 882 941 Species and Isolate                      (AF53134) S. mansoni A C T G C T A (AY446078) S. rodhaini G T C A G C G EU599378 G T T A G ? ? EU599377 A C T G G ? ? EU599376 A T C A G ? ? EU599375 A T C G G ? ? EU599374 A C T A G ? ? EU599373 A C C G G ? ? EU599372 A C C A G ? ? EU599371 A T T G G ? ? EU599370 G C C A G ? ? EU599369 G C C G G ? ? EU599368 G C T A G ? ? EU599367 G C T G G ? ? EU599366 G T C A G ? ? EU599365 G T C G G ? ? EU599364 G T T G G ? ? AF531313 G T C A C C G 4. Discussion 4.1 DNA extraction In this study a DNA extraction method suggested by Beltan et al. (2009) was used. An attempt at extracting DNA from 8 cercariae from a single miracidial infection of a snail and 20 Schistosome hybrids was performed and even though this DNA extraction method was said to be advantageous using small amounts of DNA , no bands were found to be present for RAPD or ITS-2 markers. Beltran et al. (2008) showed that from 10 cercariae the method was 98% and 100% successful in first and second amplifications retrospectively, however the results of this study indicate no DNA to be present suggesting that the protocol was not as 100% efficient as suggested. It could be that Beltran et al. (2008) analysed the DNA without using gel electrophoresis and other methods of analysing DNA[rachel da3]   were more suitable for this DNA extraction. However, it could also be the case that there were no cercariae to extract DNA from but this is unlikely as the cercariae were collected for the purposes of this study.[rachel da4] Alternatively, the DNeasy protocol used to extract the DNA from the adult hybrid worms proved to be more effective. Beltran et al. (2008) suggested that other methods of DNA extraction took time and were far more complex and even though this may be the case, the longer DNeasy protocol was far more effective at yielding DNA for this study. 4.2 Evidence of mitotic recombination in Schistosomes From a single miracidial infection of F1 hybrids, 6 genotypes have been produced supporting the theory by Bayne and Grevelding et al. (2003) that mitotic recombination is occurring in the asexual stage of the parasites life cycle within Biomphalaria snails. Although Sire et al. (1999) strongly suggested that genetic diversity was greatly reduced[rachel da5]   when there is a single miracidium infection the evidence from this study shows this to be incorrect due to the numerous genotypes observed. Multiple genotypes were seen in F1 generation produced from single miracidial infection which is indicative of recombination events. Recombination normally only happens during meiosis, however, this would not have had the opportunity to happen in the F1 thus recombination must have taken place during the asexual stage of of the life cycle. Hybrid breakdown occurs when the genetics that control physiology and development breakdown (Burton 1990) because of two gene pools and so two different sets of chromosomes mixing (Dobzhansky 1950). Therefore, a consequence of this hybrid breakdown could be mitotic recombination occurring and causing increased genetic diversity within the schistosome population. S. mansoni and S. rodhaini hybrids occur naturally (Morgan et al. 2003), and so it may be questionable   whether there are any pure species of schistosomes due to this naturally occuring hybridisation. Consequently if this hybridisation is occurring naturally all the time then increased genetic diversity within a schistosome population would be present. The host Biomphalaria snails only have an innate immune system (Minchella 1984). Therefore, if the parasite population has a high diversity of different genotypes the snail would not recognise them all as antigens allowing some strains to survive and so mitotic recombination could be a mechanism by which diversity arises in order for the parasite to evade the snail immune system (Caillaud et al. 2006). Sire et al. (1999) suggest that genetic diversity may be seen if there is higher productivity of snail hosts, due to an increased number of snails dying in response to a heavy parasite burden. Therefore, the different genotypes of the snail host that the parasite would be in contact with could affect the genetic diversity of the parasite. It is also suggested that if there is increased movement of the intermediate host, the Biomphalaria snail, it would encounter various different parasite genotypes from   other snail hosts (Sire et al. 1999). Therefore genetic diversity within schist osomes would be present. In this study mitotic recombination has caused greater genetic diversity in the female   parasite. This is vital for reproduction as it is the female that produces eggs (Clough 1981) therefore if more female genotypes able to evade the snail immune system and survive it means an increase in reproduction. The Red Queen Hypothesis is a co-evolutionary hypothesis suggesting that as the Biomphalaria snail host genes evolve the genes of the parasite that allow infectivity of the host will evolve alongside them (Van Valen 1973). Therefore, it could be this evolution of the parasite genes (Figure 6) affecting the ability of the schistosome population to infect the snail host which causes the genetic diversity (Carius et al. 2001). Figure 6. Red Queen Hypothesis showing the co-evolution of the snail host and the parasite. 4.3 The use of RAPD and rDNA markers in emphasising genetic diversity within schistosomes In this study the use of RAPD markers have been successful in highlighting the different genotypes present amongst S.mansoni and S.rodhaini hybrids. RAPD markers are therefore successful at allowing for genetic diversity to be quantified (Langand et al. 1999). RAPD markers have enabled the quantification of the different genotypes of the schistosome hybrids in this study and this is supported by Barral et al. (1996) who concluded that RAPD markers were efficient at providing a way of displaying genetic diversity within a schistosome population. Using reproducible RAPD markers is advantageous as it validates the results of this experiment as if the experiment was repeated the same results would be produced. If after repeating, the same results were found as reproducible RAPD markers were used it would further conclude that genetic diversity is definitely present in schistosome population. For the schistosome hybrids two ITS-2 bands were present on the gel and the reason for this is unclear. It could be due to lack of specific species barriers this second band has appeared. It could also be due to priming on another site, such as a viral or transposable element which has similarities to ITS-2 has inserted itself into the genome and how shown up on the gel as a second ITS band. Although it was not possible to sequence the ITS – 2 region, the sequencing generated by Steinauer et al. (2008) showed that there was genetic diversity within the F1 offspring. This genetic variation could also be caused by mitotic recombination happening within the asexual stage of the life cycle. References Archetti, M. (2003) A selfish origin for recombination. Journal of Theoretical Biology,  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   223(3), 335-346. Barral, V., Morand, S., Pointier, J.P., and Theron, A. (1996) Distribution of schistosome genetic diversity within naturally infected Rattus rattus detected by RAPD markers. Parasitology, 113(6), 511 – 517. Bayne, C.J., and Grevelding, C.G. (2003) Cloning of Schistosoma mansoni sporocysts in vitro and detection of genetic heterogeneity among individuals   within  Ã‚  Ã‚  Ã‚   clones. The Journal of Parasitology, 89(5), 1056-1060. Beltran, S., Galinier, R., Allienne, J., and Boissier, J. (2008) Cheap, rapid and  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚     Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  efficient DNA extraction method to perform multilocus microsatellite genotyping on all Schistosoma mansoni stages. Memà ³rias do Instituto   Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   Oswaldo Cruz, 103(5), 501-503. Berquist, R., Al-Sherbiny, M., Barakat, R., and Olds, R. (2002) Blueprint for schistosomiasis vaccine development. Acta tropica, 82(2), 183 – 192. Burton, R.S. (1990) Hybrid breakdown in developmental time in the copepod Tigriopus californicus. Evolution, 44(7), 1814 – 1822. Caillaud, D., Prugnolle, F., Durand, P., Theron, A. and de Meeus, T. (2006) Host sex and parasite genetic diversity. Microbes and Infection, 8(9-10), 2477 – 2483. Carius, H.J., Little, T.J. and Ebert, D. (2001) Genetic variation in host-parasite association: potential for coevolution and frequency-dependent selection. Evolution 55(6), 1136-1145. Chambers, G.K., and MacAvoy, E.S. (2000) Microsatellites: Consensus and controversy. Comparitive Biochemistry and Physiology, 126(4), 455 – 476. Clerinx, J., and Van Gompel, A. (2011) Schistosomiasis in travellers and migrants. Travel Medicine and Infections Disease, 9(1), 6-24. Clough, E.R. (1981) Morphology of Reproductive Organs and Oogenesis in Bisexual and Unisexual Transplants of Mature Schistosoma mansoni Females. The Journal of Parasitology, 67(4), 535-539. Curtis, J., and Minchella, D.J. (2000) Schistosome Population Genetic Structure: When Clumping Worms is not just splitting hairs. Parasitology Today, 16(2), 68-71. Dabo, A., Durand, P., Morand, S., Diakite, M., Langand, J., Imbert-Establet, D., Doumbo, O., and Jourdane, J. (1997) Distribution and genetic diversity of Schistosoma haematobium within its bulinid intermediate hosts in Mali. Acta Tropica, 66 (1), 15-26. Dobzhansky, T. (1950) Genetics of natural populations. XIX. Origin of heterosis through natural selection in populations of Drosophila pseudoobscura. Genetics 35(3), 288 – 302. Durand, P., Sire, C., and Theron, A. (2000) Isolation of microsatellite markers in the digenetic trematode Schistosoma mansoni from guadeloupe island. Molecular Ecology, 9(7), 997-998. Dybdahl, M.F. And Storfer, A. (2003) Parasite local adaptation: Red Queen versus Suicide King. Trends in ecology and evolution 18(10), 523-530. Gower, C.M., Shrivastava, J., Lamberton, P.H.L., Rollinson, D., Webster, B.L., Emery, A., Kabatereine, N.B., and Webster, J.P. (2007) Development and application of an ethically and epidemiologically advantageous assay for the multi-locus microsatellite analysis of Schistosoma mansoni. Parasitology, 134(4), 523-536. Grevelding, C. G. (1999) Genomic instability in Schistosoma mansoni. Molecular and Biochemical Parasitology, 101(1-2), 207-216. Gryseels, B., Polman, K., Clerinx, J., and Kestens, L. (2000) Human schistosomiasis. The Lancet, 368(9541), 1106-1118. Ismail, M., Botros, S., Metwally, A., William, S., Farghally, A., Tao, L. F., Day, T.A., and Bennett, J.L. (1999) Resistance to praziquantel: Direct evidence from Schistosoma mansoni isolated from egyptian villagers. The American Journal of Tropical Medicine and Hygiene, 60(6), 932-935. Langand, J., Theron, A., Pointier, J.P., Delay, B., and Jourdane, J. (1999) Population structure of Biomphalaria Glabrata, intermediate snail host of Schistosoma mansoni in Guadeloupe Island using RAPD markers. Journal of Molluscan Studies, 65(4), 425-433. Lynch, M., and Milligan B.G. (2004) Analysis of population genetic structure with RAPD markers. Molecular Ecology, 3(2), 91-99. Mann, V.H., Morales, M.E., Rinaldi, G., and Brindley, P.J. (2009) Culture for genetic manipulation of developmental stages of Schistosoma mansoni. Parasitology, 137(3), 451-462. Minchella, D.J. (1984) Host life-history variation in response to parasitism. Parasitology, 90(1), 205-216. Morgan, J.A.T., DeJong, R.J., Lwambo, N.J.S., Mungai, B.N., Mkoji, G.M. and Loker, E.S. (2003) First report of a natural hybrid between Schistosoma mansoni and S. rodhaini. The Journal of Parasitology, 89(2), 416-418. Rodrigues, N., Coura Filho, P., De Souza, C., Jannoti Passos, L., Dias-Neto, E., and Romanha, A. (2002) Populational structure of Schistosoma mansoni assessed by DNA microsatellites. International Journal for Parasitology, 32(7), 843-851. Simoes, M., Bahia, D., Zerlotini, A., Torres, K., Artiguenave, F., Neshich, G., Kuser, P., and Oliveira, G. (2007) Single nucleotide polymorphisms identification in expressed genes of Schistosoma mansoni. Molecular and Biochemical Parasitology, 154(2), 134-140. Sire, C., Durand, P., Pointier, J. P., and Thà ©ron, A. (1999) Genetic diversity and recruitment pattern of schistosoma mansoni in a Biomphalaria glabrata snail population: A field study using random-amplified polymorphic DNA markers. The Journal of Parasitology, 85(3), 436-441.

Effect of Tax on the Selling of Apples in a Small Scale Assignment

Effect of Tax on the Selling of Apples in a Small Scale - Assignment Example This scenario takes two rounds or instances of selling and the supplier’s interest are the amount of profit. According to the data, in round 1 the supplier sold a bushel of apples at $10 and the second round at $19. The formula to calculate profit is: In the second set of data, session #1 has apples sold for every unit from 1 to 20. The indication is that the demand for the apples is high when there is no tax charged during the buying and selling of the apples. The demand for the apples in the experiment is less elastic than the supply. In the second session, the supplier bears the tax burden. In the experiment, the apple supplier still has a seller cost of $18 for a bushel of apples. Above the seller cost, the supplier must pay a sales tax of $15. However, if the seller does not sell any apples, he does not pay either seller cost or sales tax. From the record of prices and profits, the supplier never sold a bushel of apples in either round 1 or 2 showing a significant decline in the profits to zero when the supplier pays the tax. From the second data set, session #2 indicates a drop in the supply of the apples. In the first 14 units sold, the sellers supply pattern indicates some increase in volumes of the sales of apple. On the other hand, from 15 to 20 units, the seller never sold any apples due to the high costs from taxes. The tax burden shifts to buyers in the third session. The supplier of apples in the first set of data does not sell any apples due to drop in demand since the buyers deter from buying. In the second data set, the buyers could still afford the bushel of apples for up to 12 units sold. From 13 to 20 units, the supplier does not sell any apples. This experiment uses a method of comparative statistics to analyze the effect of the tax on demand and supply. The economic theory that comes into play in this scenario is the optimal tax theory. This theory  suggests the best way to affect taxation with minimal distortion of the demand and supply. According to this theory, the sales tax imposed on suppliers and buyers has the same effect; reducing the demand and supply.

Question Answers Essay Example | Topics and Well Written Essays - 750 words

Question Answers - Essay Example His vision asserts that his team should control the things it can while striving to achieve goals in an efficient manner. Answer: The three important leadership roles Todman emphasizes include: (1) Leader as a team builder: Todman ensured that team worked on a collaborative platform where all the members could meet each other more often than before, such as once a month rather than once every two months. (2) Leader as a problem-solver: Todman made sure that right decisions were made at the right time to ensure business success, just like a Whirlpool executive stated about Todman that he was able to solve problems by making the team an interconnected unit. (3) Leader as a strategic planner: Todman revamped the new Maytag product line; closed the expensive plants; and, planned on educating the whole staff. This expresses his proficiency as a strategic planner. Answer: Louie’s financial management strategies are okay as people have been appreciating him in this regard, but his interpersonal relationships at the workplace are not satisfactory. For example, Emma, the human resources manager of the company, came across some customer feedback cards that complaint about Louie’s unsuitable remarks which were too personal. Louie’s has not been appropriately responsive toward the customers. He is not very tolerant about cultural diversity at the workplace. He has also been acting too frankly with the co-workers at times, for example, giving a high-five or a fist bump. These gestures have been making him unpopular at the workplace. Answer: Louie needs some serious training regarding tolerance about cultural diversity at the workplace. He needs to understand that all individuals are equally worthy of respect regardless of their cultural, racial and ethnic backgrounds. He needs to show tolerance toward all kinds of people with varying sexual orientation. He also needs to understand his limitations at the workplace, such as how he should behave